@article{PAR00002154,
  title = {{F}irst report of {R}ice yellow mottle virus in rice in the {G}ambia [r{\'e}sum{\'e}]},
  author = {{S}ere, {Y}. and {S}orho, {F}. and {O}nasanya, {A}. and {J}obe, {L}. and {D}arboe, {S}. and {B}ojang, {Y}. and {T}ouray, {M}. {L}. and {P}inel {G}alzi, {A}gn{\`e}s and {F}argette, {D}enis},
  editor = {},
  language = {{ENG}},
  abstract = {{R}ice yellow mottle virus ({RYMV}) of the genus {S}obemovirus is a major biotic constraint to rice ({O}ryza sativa) production in {A}frica. {F}irst reported in {K}enya during 1966, {RYMV} was later found in most countries in {A}frica where rice is grown (1). {I}n countries in westernmost {A}frica ({T}he {G}ambia, {G}uinea-{B}issau, {M}auritania, and {S}enegal), plants with leaf yellowing and mottling symptoms were observed, but {RYMV} was never isolated. {R}ice is the staple food in {T}he {G}ambia. {I}n 2006, four samples were collected from local rice varieties in the {K}untaur {R}egion in the center of {T}he {G}ambia. {M}echanical inoculation with leaf extracts from all samples caused typical yellow mottle symptoms on the susceptible rice varieties {BG}90-2, {B}ouak{\'e} 189, and {IR}64. {RYMV} was detected in the four samples collected by {ELISA} with polyclonal antisera (2). {T}he 720-nt coat protein gene was amplified for each isolate by reverse-transcriptase-{PCR} with primers 5'-{CAAAGATGGCCAGGAA}-3' (sense) and 5'-{CTCCCCCACCCATCCCGAGAATT}-3' (antisense) (2). {T}he {RT}-{PCR} products were directly sequenced ({EMBL} {A}ccession {N}os. {AM}765810, {AM}765811, {AM}765812, and {AM}765813) and then aligned using {C}lustal{W} with a pool of {RYMV} coat protein sequences from {W}est {A}frican isolates ({EMBL} {A}ccession {N}os. {AJ}279905, {AJ}279901, {AJ}885137, {AJ}885124, and {AJ}279935). {P}hylogenetic reconstruction by maximum-likelihood with {PAUP} indicated that the isolates from {T}he {G}ambia formed a monophyletic group with over 97% nucleotide identity and are closely related to isolates of other countries in {W}est {A}frica ({B}urkina {F}aso, {C}{\^o}te d'{I}voire, {G}uinea, {M}ali, and {S}ierra-{L}eone) with 91 to 94% identity. {D}etection of {RYMV} in {T}he {G}ambia indicates that {RYMV} is present in westernmost {A}frica, which is referred to as the 'rice belt' of {A}frica, and shows that {RYMV} is widely distributed from eastern {A}frica ({T}anzania) to the western part of the continent.},
  keywords = {{GAMBIE}},
  booktitle = {},
  journal = {{P}lant {D}isease},
  volume = {92},
  numero = {2},
  pages = {316},
  ISSN = {0191-2917},
  year = {2008},
  DOI = {10.1094/{PDIS}-92-2-0316{B}},
  URL = {https://www.documentation.ird.fr/hor/{PAR}00002154},
}